Journal Search Engine
Search Advanced Search Adode Reader(link)
Download PDF Export Citaion korean bibliography PMC previewer
ISSN : 1225-4339(Print)
ISSN : 2287-4992(Online)
The Korean Journal of Food And Nutrition Vol.34 No.1 pp.58-68
DOI : https://doi.org/10.9799/ksfan.2021.34.1.058

Quality Characteristics and Comparison of Microbial Community in Traditional Doenjang by Aging Period in Gyeongnam Province

Hyeon-Young Kim, Bong Sin Kim, Hee-Suk Ko*, So-young Kim**, Gi-Jeong Ha†
Researcher, Gyeongnam Agricultural Research and Extension Services, Jinju 52733, Korea
*Senior Researcher, Gyeongnam Agricultural Research and Extension Services, Jinju 52733, Korea
**Researcher, Fermented Food Science Division, National Institute of Agricultural Science, RDA, Wanju 55365, Korea
Corresponding author: Gi-Jeong Ha, Researcher, Gyeongnam Agricultural Research and Extension Services, Jinju 52733, Korea.
Tel: +82-55-254-1872, Fax: +82-55-254-1859, E-mail: hkjone@korea.kr
25/11/2020 04/01/2021 13/01/2021

Abstract


This study investigated the microbial community and quality characteristics of traditional soybean pastes (doenjang) based on the aging period in Gyeongnam province. The samples were collected from seven regions in Gyeongnam Province (Goseong, Hadong, Haman, Hamyang, Sacheon, Sancheong and Uiryeong). Contents of moisture, salinity, pH, and acidity of doenjang after 210 days aging were 56.40~65.21%, 9.05~16.08%, 4.88~6.86 and 0.64~2.14%, respectively. Lightness significantly decreased over the aging period, while the redness tended to increase over the aging period. Yellowness was from 21.39~26.81 to 21.10~28.36. Reducing sugar content was from 0.31~1.45% to 0.11~3.13%. The amino-type content increased from 141.87~495.13 mg/100 g to 328.53~823.67 mg/100 g. In contrast, the ammonia-type content declined from 136.74~364.70 mg/ 100 g to 128.62~331.00 mg/100 g. The overall total microbial count did not significantly differ, but it tended to decrease in sample GD4. Fungus declined overall or was not detected. Coliform groups were not detected in all samples. Lactobacillus and Bacillus cereus tended to decrease over the aging period. The common fungus and bacterium were Aspergillus oryzae and Tetragenococcus halophilus, respectively. After the aging period, the predominant fungi were Candida versatilis, Candida apicola, and Debaryomyces hansenii. The predominant bacteria were Tetragenococcus halophilus and Cronobacter sakazakii.



경남지역 전통 된장의 숙성기간에 따른 품질 특성 및 미생물 군집 비교

김 현영, 김 봉신, 고 희숙*, 김 소영**, 하 기정†
경상남도농업기술원 지방농업연구사
*경상남도농업기술원 지방농촌지도관
**국립농업과학원 지방농업연구사

초록


    서 론

    된장은 콩을 주원료로 하여 발효, 숙성시킨 단백질 공급 식품으로 우리나라의 대표적인 대두 발효식품이다(Kim 등 2006). 이와 같은 된장은 발효과정 중 곰팡이와 세균이 생성 한 amylase, protease 등의 효소 작용으로 아미노산, 당분 등이 생성되어 식염의 짠맛과 조화를 이루고 향미성분이 생성되 어 된장의 고유한 맛인 구수한 맛, 감칠맛을 만들어낸다(Seo 등 1986).

    된장은 기능적․영양학적으로도 우수하여 필수 아미노산, 유기산, 지방산 및 비타민 등을 보충해줄 수 있어 영양원으로 서 매우 중요하다(Kim 등 2006). 또한 된장의 항산화(Hwang 등 2017;Song 등 2019), 콜레스테롤 저하(Lee 등 2011), 항암 (Park 등 1999;Lee & Chang 2009), 항비만(Bae 등 2013), 및 항당뇨 효과(Yang 등 2019) 등의 기능성에 대한 효능도 입증 되고 있다.

    된장은 제조방법에 따라 재래식 된장과 개량식 된장으로 분류한다. 재래식 된장은 대두를 삶아 한식메주를 만들고 이 것을 소금물에 침지시켜 발효 시킨 후 된장과 간장을 분리하 여 장을 가른 후 항아리에 숙성시켜 만든 것이다. 개량식 된 장은 쌀, 보리 또는 밀 등과 같은 전분질 원료에 Aspergillus oryzae 등의 황국균을 인위적으로 접종, 배양하여 코지를 만 들고 여기에 증자대두와 소금을 혼합하여 숙성시켜 만든 것 이다(Kim 등 2008).

    전통 된장의 품질은 지역별, 제조 방법, 담금 시기, 발효 용기, 지역의 기후 및 풍토에 따라 각기 다른 특성을 나타낸 다(Park 등 2017). 따라서 전통 된장의 품질 특성에 대한 많은 연구가 되고 있는데, 전통 된장의 숙성 중 이화학성분, 미생 물 및 효소활성 변화(Lee 등 1996), 인삼 농축액 첨가에 따른 재래식 된장 발효 과정중의 미생물 및 기능성의 변화(Jang 등 2000), 전통 된장의 숙성 중 관능적 품질에 미치는 성분의 변 화(Kim JG 2004), 황기 추출액이 함유된 된장의 품질 특성 조사(Min SH 2006), 재래된장의 미생물 오염 및 바이오제닉 아민 함량 분석 조사(Lee 등 2009), 혼합콩이 전통된장의 숙 성 중 품질에 미치는 영향(Kim 등 2010), 전통된장 제조 과정 중 세균군집구조 분석(Kim 등 2011a), 재래된장의 품질 및 항 산화 특성(Ahn 등 2012), 죽염 된장의 발효 특성 및 기능성 증진 효과(Jeong 등 2013), 마늘 첨가 된장의 숙성 중 품질 특성 변화(Kang 등 2014), 장 담금법에 따른 품질 특성 변화 (Choi 등 2017), 염생식물을 첨가한 저염된장의 이화학적 특 성 변화(Choi 등 2018), 뿌리채소 분말을 첨가한 된장의 품질 특성 조사(Paek 등 2019) 등의 연구로 활발히 진행 되고 있다. 하지만 지역별로 분류하여 전통된장이 숙성기간에 따른 품 질 및 미생물 군집에 대한 연구는 미비한 실정이다.

    따라서 본 연구에서는 경남지역의 전통 장류 제조업체를 지역별로 7개소를 선정하여 재래식으로 제조한 전통 된장을 수집한 후 숙성 기간에 따른 품질 특성 및 미생물 변화를 측 정하고, 숙성 전․후로 미생물 군집을 비교 분석 함으로써 경 남 지역별 장류의 특성을 파악하고, 경남지역의 microbial community 확보 및 품질관리 지표에 활용하고자 수행하였다.

    재료 및 방법

    1. 재료

    경남지역에서 각 지역별로 전통 장류 7업체(고성, 사천, 산 청, 의령, 하동, 함안, 함양)를 선정하여 각 업체에서 만든 전 통 메주를 이용하여 전통 재래식 된장으로 제조하였다. 메주 는 2018년도 12월에 생산하여 15~20일간 발효 후 30~60일간 숙성시킨 메주를 사용하였고, 업체 선정 기준은 전통식품인 증업체, 지역농산물 활용, 부원료 미사용 업체를 고려하여 선정하였다. 2019년 3월 중순에 장을 담근 후 노지에서 90일 간 발효 후 간장과 분리하여 고형분인 된장을 치대어 항아리 에 담아 숙성 시켰다. 숙성 조사 시기는 2019년 6월 중순에 장 가른 직후, 숙성 30일 후, 숙성 90일 후, 숙성 210일 후의 시료를 수집하여 실험의 시료로 사용하였다. 미생물 군집 분 석에 사용된 시료는 7업체 중 4업체(고성, 사천, 하동, 함양) 를 선정하여 장 가른 직후 및 210일 숙성 후의 시료를 수집하 여 분석하였다. 수집한 시료는 -70℃ 냉동고에 보관하면서 사용하였다.

    2. 수분 및 염도 측정

    된장의 수분 및 염도는 식품공전(KFDA 2015)에 따라 측정 하였다. 수분은 상압가열건조법으로 분석하였고, 염도는 시 료 2.5 g에 증류수 47.5 mL를 가해 잘 교반한 뒤 여과지 (Whatman No. 2, Whatmnad Int. Ltd., Maidstone, UK)로 여과 하였다. 여과된 시료는 10 mL 분주 후 K2CrO4 지시약 2~3방 울 첨가하였다. 0.1 N 질산은(AgNO3)으로 적정하여 색깔이 변하는 시점의 양을 적정 mL로 하여 분석하였다.

    3. pH 및 산도

    된장의 pH는 시료를 5배 희석하고 균질화한 후 8,000 rpm 에서 10분간 원심분리(2236HR high-speed centrifuge, Gyrozen Co., Ltd, Gimpo, Korea)하였다. 이 상층액을 여과지로(Whatman No. 2, Whatmnad Int. Ltd., Maidstone, UK) 여과한 후 pH meter(Titroline Easy, Schott, Mainz, Germany)로 측정하였다. 산도는 시료추출액 5 mL와 증류수 20 mL를 섞고, 0.5% 페놀 프탈레인 지시약을 2~3방울 떨어트린 뒤, 0.1 N NaOH 용액 으로 미홍색(pH 8.2~8.3)이 지속될 때 까지 적정하였다. 적정 에 소비된 0.1 N NaOH 양을 측정하여 젖산 환산계수(0.0090) 로 계산하였다.

    4. 색도 측정

    색도는 색차계(CM-3500d, Minolta, Tokyo, Japan)를 이용하 여 측정 후 Hunter value의 명도 값(L, lightness), 적색도 값(a, redness), 황색도(b, yellowness) 값으로 나타내었다. 표준백색 값은 L=96.73, a=-0.15, -0.14이었다.

    5. 환원당 측정

    된장의 환원당은 DNS법(Yang 등 2000)에 따라 시료를 10 배 희석한 뒤 시료추출액 1 mL, DNS(dinitrosalicylic acid)시약 3 mL를 혼합하였다. 끓는 물에 5분간 중탕하고 냉각한 후 550 nm 파장으로 흡광도(infinite M200 PRO, TECAN, Männedorf, Switzerland)를 측정하였다. 포도당을 표준물질로 하여 검량 곡선을 나타내어 환원당 함량(%)을 계산하였다.

    6. 아미노태 질소 및 암모니아태 질소 측정

    아미노태 질소는 시료추출액 5 mL, 중성 formalin 용액(pH 8.3) 10 mL과 증류수 10 mL을 혼합하였다. 이 혼합액에 0.1 N 수산화나트륨 용액으로 미홍색(pH 8.4)이 될 때 까지 적정 하였다. 이때 소비된 0.1 N NaOH 양을 적정 mL로 하였다. 바 탕시험은 증류수를 이용하여 분석하였다. 암모니아태 질소는 Choi 등(2017)의 방법에 따라 시료 추출액 0.1 mL에 A용액 (phenol and sodium nitroprusside dehydrate)과 B용액(Na2HPO4․ 12H2O, NaOH and NaOCl)을 각각 2 mL씩 차례로 넣고 37℃ 에서 20분간 반응시켜 630 nm에서 흡광도(infinite M200 PRO, TECAN, Männedorf, Switzerland)를 측정하였다. 황산암 모늄을 표준물질로 하여 작성한 검량곡선으로부터 암모니아 태 질소 함량(mg/100 g)을 계산하였다.

    7. 미생물 분석

    된장의 미생물학적 품질평가를 위해 총균수, 곰팡이, Bacillus cereus, 대장균군 및 유산균을 분석하였다. 시료 1 g에 0.85% 멸균 생리식염수 9 mL를 넣어 십진희석법에 따라 희석액을 제조하였다. 총균수는 plate count agar(PCA)를 사용하여 건조 필름 배지(AC)에 접종하였다. 곰팡이는 YM 배지에 접종하 여 계수하였고, 대장균군은 건조필름배지(EC)에 접종하였 다. 유산균수는 30℃에서 48~72시간 혐기 배양을 하여 흰색 의 집락을 계수하였다. Bacillus cereus(BC)는 CHROMagar BC 배지를 이용하여 파란색의 흰 halo가 있는 집락을 계수하 였다. 모든 단위는 log CFU/g로 환산하여 나타내었다.

    8. 미생물 군집 분석(NGS, next generation sequencing)

    미생물 군집 분석은 Baek 등(2019)의 방법과 동일하게 진 행하였다. Genomic DNA 추출은 DNeasy PowerSoil Kit(Cat. No.12888, MO BIO, Carlsbad, CA, USA)를 사용하였다. 추출 된 DNA에서 세균군집은 16S rRNA 유전자의 16S V3-V4 primer를 이용하였고, 진균군집은 Fungi ITS2 유전자의 ITS3- ITS4 primer를 이용하여 PCR을 수행하였다. 추출된 total genome DNA를 주형(template)으로 16S ribosomal DNA amplicon 및 ITS amplicon을 확보하기 위하여 341F(TCGTCGGCAGC GTCAGATGTGTATAAGAGACAGCCTACGGGNGGCWGCA G), 805R(GTCTCGTGGGCTCGGAGATGTGTATAAGAGACA GGACTACHVGGGTATCTATCC)를 기반으로 하는 bacterial 프라이머와ITS-3F(TCGTCGGCAGCGTCAGATGTGTATAA GAGACAGGCATCGATGAAGAACGCAGC), ITS-4R(GTCTCG TGGGCTCGGAGATGTGTATAAGAGACAGTCCTCCGCTTA TTGATATGC)을 기반으로 하는 ITS3-4 프라이머를 사용하 여 1차 PCR을 진행하였다. 1차 PCR 반응은 변성부터 DNA합 성 과정을 25회 반복하였다. 초기 변성(initial denaturation)은 95℃ 3분, 변성(denaturation)은 95℃ 30초, 프라이머 결합 (annealing)은 55℃ 30초, DNA 합성(extension)은 72℃ 30초, 최종 신장(elongation)은 72℃ 5분의 조건에서 수행하였다 (Cho 등 2017). Target region을 증폭하는 1차 PCR 진행 후 Nextra XT index kit를 이용하여 Barcode를 붙이는 2차 PCR 방법으로 라이브러리를 제작했다. 정제된 PCR 산물은 동량 모아서 TapeStation DNA screentape D1000(Agilent)으로 증폭 산물의 길이와 농도를 측정하였다. 최종 PCR 산물은 차세대 염기서열 분석인 MiSeq™ platform(Illumina, San Diego, USA) 를 사용하여 제조사의 매뉴얼에 따라 Macrogen Inc. (Seoul, Korea)에서 수행하였다.

    9. 통계처리

    본 실험에서 얻어진 결과는 XLSTAT program(Addinsoft, Paris, France)을 이용하여 ANOVA 검정과 Duncan’s multiple range test 방법을 이용하여 실험군의 3반복 평균값 간에 유의 수준 p<0.05에서 유의성을 검정하였다.

    결과 및 고찰

    1. 수분 및 염도 변화

    경남지역의 전통장류 7개 된장의 숙성기간에 따른 된장의 수분 및 염도 변화는 Table 1과 같다. 간장과 분리한 직 후 수분함량은 56.42~63.67%에서 숙성 후 56.40~65.21%로, 시료 마다 일정한 경향은 나타나지 않았다. GD1, GD3 시료는 유 의적으로 감소하는 경향을 보인 반면, GD5, GD7 시료는 각 각 2.4, 2.7% 증가하는 경향을 보였다. Park 등(2016)의 전통 된장 수분 함량은 51.9~63.1%로 보고하였는데, 이는 본 실험 의 연구와 유사한 값을 보였다. 또한 Yoon 등(2019)의 충북지 역 전통 된장의 숙성 초기 및 후기 수분 함량을 비교한 결과, 초기 58.07~68.86%에서 후기 52.32~63.79%로 보고하였고, 숙 성 후 본 연구와 비슷한 경향을 보였다. 숙성 후 된장별 수분함 량이 다른 경향을 보이는 것은 항아리 내․외부 온도, 습도 등 환경 조건이 수분 증발에 영향을 미치는 것으로 사료된다.

    식염은 된장 발효 시 부패를 방지하고, 저장기간을 연장시 키는 중요한 역할을 한다(Cho 등 2014). 간장 분리 직후 된장 의 염도는 9.24~14.43%로 나타났고, 210일 숙성 후 9.05~ 16.08%의 값을 나타냈다. GD1 시료는 58.3%로 가장 큰 증가 를 보인 반면, GD6 시료는 14.0%의 가장 큰 감소를 보였다. GD2, GD4 및 GD7 시료는 숙성 초기와 유의적 차이가 없는 것으로 나타났다(p<0.05). GD3 시료는 4달 숙성 후 16.43%로 가장 높은 값을 보였다. Cho 등(2014)은 마늘을 10% 첨가한 된장에 식염 첨가량을 6~12%로 저염 된장으로 제조하고 숙 성기간에 따른 품질 특성을 보았는데, 숙성기간이 경과할수 록 염도도 증가하는 경향을 보였다. 숙성 후 된장의 염도가 증가하는 것은 숙성 중 간장이 우러나와 시료의 염분에 영향 을 미치는 것으로 생각된다. 그러나 Kim 등(2008)은 숙성 온 도를 달리하여 180일간 발효 숙성 후 염도 함량 변화를 보았 는데, 저장 기간에 따른 염도의 증감은 큰 차이를 보이지 않 았다. 이러한 이유는 된장 제조 시 염분을 계산하여 식염수 로 만들어 정량적으로 첨가하였기 때문이라고 보고하였다.

    2. pH 및 산도 변화

    된장은 숙성 중 발효미생물의 대사로 인해 휘발성 또는 비 휘발성의 다양한 유기산이 생성됨에 따라 pH 및 산도의 함 량 변화에 영향을 미친다(Ku 등 2014). 숙성 기간에 따른 pH 및 산도의 결과는 Table 1과 같다. 장 담근 직 후 된장의 pH는 4.58~6.15에서 숙성 후 4.88~6.86의 범위를 보였다. GD1, GD3 및 GD7 시료를 제외하고 전반적으로 증가하는 경향을 보였 으며, 특히 GD5 시료가 49.8%의 증가로 가장 높은 pH 값을 보였다. Park 등(2016)의 연구에서 지역별 전통 된장의 pH 값 을 본 결과, 4.67~6.15의 범위를 나타냈고, 본 연구와 유사한 값을 보였다. 장 담근 직 후 된장의 산도는 0.85~1.67%에서 0.64~2.14%의 범위를 나타냈다. GD5 시료를 제외하고 모든 시료는 산도가 유의적으로 증가하였다(p<0.05). Song 등 (2019)은 전북 지역별 전통 된장의 품질 특성을 보았는데, 숙 성 후 0.53~1.77%의 범위를 나타냈고, 숙성이 진행됨에 따라 산도도 증가하여 유사한 결과임을 알 수 있었다. Joo 등(1992) 의 연구에서 된장의 숙성 중 acetic acid, succinic acid, citric acid 등의 유기산이 검출되었으며, 이러한 유기산의 지속적 인 생성이 산도의 증가에 영향을 미치는 것으로 생각된다.

    3. 색도 변화

    된장의 색은 콩의 단백질과 전분이 분해되어 생성된 당과 아미노산의 화학반응인 Maillard 반응인 비효소적 갈변에 기 인한다(Himenokunio 등 1973;Choi 등 2017). 따라서 이러한 비효소적 갈변으로 인해 숙성 기간이 경과함에 따라 갈변 현 상을 보이며 색 변화가 나타난다. 숙성기간에 따른 색도 변 화는 Hunter’s scale의 L, a, b 값으로 나타냈으며, 그 결과는 Fig. 1과 같다. 장 담근 직후 명도(L, lightness)값은 28.35~ 55.17에서 숙성 후 30.92~44.83의 값을 나타냈다. GD1 및 GD7 시료를 제외하고 나머지 시료는 전반적으로 명도 값이 감소하였으며, 숙성 전 밝은 색을 보였다가 점차 어두워지는 경향을 보였다. Song 등(2019)의 연구에서는 숙성 후 명도 값 이 감소하는 경향을 보였고, 갈변이 진행함에 따라 점차 갈 색화로 인해 명도 값이 감소하는 것으로 생각된다. 적색도(a, redness)값은 장 담근 직 후 7.97~12.72에서 숙성 후 9.38~ 12.96의 범위를 나타냈다. GD7 시료를 제외한 모든 시료에서 는 유의적으로 증가하였다(p<0.05). Kwak 등(2003)은 갈변억 제제 처리 후 된장의 색도를 본 결과, 숙성 기간이 지남에 따라 a 값이 증가하는 경향을 보였다. 이는 갈변이 진행되면 서 붉은 색의 값이 증가되는 것으로 보고하였으며, 본 연구 결과와 비슷한 경향을 나타냈다. 황색도(b, yellowness)는 장 담근 직 후 21.39~26.81에서 숙성 후 21.10~28.36의 값을 보였 다. GD1 시료는 32.6%의 증가를 보였고, GD7 시료는 11.6% 의 감소를 보임에 따라 일정한 경향은 나타나지 않았다. 숙 성 후 일정한 경향을 보이지 않는 것은 콩의 품종, 장 숙성 조건 등에 따라 경향이 다르게 나타날 수 있다고 생각된다 (Choi 등 2017).

    4. 환원당 함량 변화

    된장에서의 환원당은 단맛을 나타내는 성분이며, 콩의 전 분이 당화 효소인 amylase의 작용으로 분해되어 생성된다 (Cho & Yoon 2020). 경남지역 전통 된장의 숙성 기간에 따른 환원당 함량은 Table 1과 같다. 숙성 전 환원당 함량은 0.31~ 1.45%에서 숙성 후 0.11~3.13%의 범위를 보였다. 숙성 후 전 반적으로 감소하는 경향을 보였으나, GD2 및 GD6 시료는 유 의적으로 증가하는 것을 볼 수 있었다(p<0.05). 특히 GD2 시 료가 숙성 초기와 비교해 볼 때 가장 큰 폭으로 증가하였다. 환원당과 pH의 상관관계를 분석한 결과, 환원당의 pH와 양 의 상관성이 높아 환원당 함량이 높으면 pH 값은 높아지는 것을 나타낸다. 환원당 함량이 높다는 것은 아직 당이 유기 산으로 넘어가지 못하였음을 의미한다(Byun 등 2014). GD2, GD6 시료는 숙성 후 pH가 증가함에 따라 환원당의 함량도 증가하는 것으로 생각된다. Kim 등(2011b)은 시중에 판매하 는 쌀된장의 환원당 함량을 보았는데, 0.21~0.55%의 범위를 보였고, 본 연구 결과에 비해 낮은 환원당 함량을 보인다. 이 는 전분이 당화 효소인 amylase에 의해 모두 이용되어 낮은 함량을 보인다고 보고하였다. Kim 등(2006)의 연구에서는 된 장의 숙성기간이 경과함에 따라 환원당 함량이 전반적으로 낮아지는 경향을 보였다. 환원당의 함량이 감소하는 것은 된 장 내 미생물의 영양원, 유기산 숙성 기질로 이용되므로 숙 성 기간이 경과하면서 함량이 감소하게 된다(Yoo 등 2000).

    5. 아미노태 질소 및 암모니아태 질소 함량 변화

    된장의 아미노태 질소 및 암모니아태 질소 함량 측정 결과 는 Table 1과 같다. 아미노태 질소는 유리 아미노산의 아미노 기의 질소나 carboxyl group을 측정하는 것으로 유리되는 아 미노산이 많으면 증가한다(Ku 등 2014). 아미노태 질소는 담 금 직 후 141.87~495.13 mg/100 g에서 숙성 후 328.53~823.67 mg/100 g으로 숙성 기간이 경과함에 따라 점차적으로 유의 하게 증가하였다(p<0.05). 아미노태 질소 함량은 된장의 숙성 도를 판단하는 지표가 되며, 된장의 숙성 중 콩 단백질이 효소 작용으로 가수분해되어 아미노산을 생성한다(Kim JG 2004). 또한 아미노태 질소는 된장의 고유한 맛인 구수한 맛 성분과 도 밀접한 관련이 있다고 알려져 있다(Kim 등 2006). 일반적 으로 숙성이 진행됨에 따라 아미노태 질소 함량도 증가한다 (Kang 등 2013). Kim 등(2000)Song 등(2019)의 연구에서 도 숙성기간이 증가함에 따라 아미노태 질소 함량이 증가하 였으며, 본 연구와 유사한 결과를 보였다. 현재 아미노태 질소 는 전통식품 표준규격(National Agricultural Products Quality Management Service)에서 300 mg/100 g 이상으로 규정하고 있으며, 7개 시료 모두 규격에 적합하였다.

    암모니아태 질소는 단백질이 분해하는 과정에서 탈아미 노반응에 의해 생성되며, 함량이 증가할수록 이취를 풍기며 된장의 품질을 저하시키는 요인이다(Lee 등 2016). 경남지역 전통장류 암모니아태 질소 함량은 숙성 초기 136.74~364.70 mg/100 g에서 숙성 후 128.62~331.00 mg/100 g으로 GD3, GD5 시료를 제외하고 전반적으로 감소하는 경향을 보였다. Choi 등(2017)의 연구에서도 된장 숙성 6개월 후 암모니아태 질소 가 전반적으로 감소하는 경향을 보여, 본 연구 결과와 유사 하였다. Lee 등(2012)은 메주형태와 starter 첨가에 따른 쌀된 장의 암모니아태 질소 함량을 측정했는데, 숙성 초기에는 44.02~208.07 mg/100 g에서 42일 숙성 후 256.33~639.29 mg/ 100 g으로 숙성기간 동안 크게 증가하는 경향을 나타냈다. Song 등(2019)은 전북 지역의 암모니아태 질소 함량은 숙성 후 평균적으로 177.83 mg/100 g으로, 본 연구의 숙성 후 결과 값보다 낮은 함량을 보였고, 숙성 후 모든 시료가 증가하였 다는 결과와는 상이하였다. 이렇게 증가하는 이유는 숙성 중 단백질 분해 효소인 protease 등 활성이 활발해져 휘발성 질 소인 암모니아태 질소의 함량도 증가하는 것으로 생각된다 (Song 등 2019).

    6. 미생물 변화

    된장은 다양한 미생물의 생육으로 인해 숙성기간 동안 효 소작용이 활발히 일어나 맛과 향을 비롯한 품질에 영향을 받 는다(Choi 등 2018). 경남지역에서 제조된 전통 된장의 미생 물 측정 결과는 Table 2와 같다. 총 균수는 담금 직 후 5.61~ 9.13 Log CFU/g에서 210일 숙성 후 4.91~9.24 Log CFU/g의 범위를 보였으며, 숙성 후 전반적으로 담금 초기와 유의적 차이가 없거나, 뚜렷한 증가를 나타내지 않았고, GD4 시료만 5.61 Log CFU/g에서 4.91 Log CFU/g로 감소하였다. Choi 등 (2017)의 연구에서는 메주 된장에 염 농도별(8, 12%)로 첨가 하여 24주 숙성시킨 결과, 생균수는 증가하는 경향을 보였 고, 평균값은 7.6 Log CFU/g으로 본 연구의 결과 값에 비해 낮은 값을 보였다. Lee 등(2020)은 재래식 된장을 발효용기별 (옹기, 자기, stainless steel 용기, 유리병)로 숙성한 후 미생물 변화를 보았는데, 무유옹기나 시유옹기에 보관된 된장은 총 균수가 7.6~8.2 Log CFU/mL을 보였으며, 다른 용기보다는 옹 기에서 된장을 숙성시킬 경우 총 균수가 유의적으로 감소하 는 결과를 보여, 본 연구결과와 상이한 결과를 보였다. 발효 식품을 옹기에 숙성시킬 경우 기공율이 높은 옹기에서 산소 투과율이 가장 높아 총 균수 증가율이 줄어든다고 하였다 (Chung 등 2004;Lee 등 2020). 이와 같이 총 균수는 숙성 옹 기에 따라서도 큰 영향을 미치며, 전통 된장별로도 총 균수 의 차이가 나는 이유는 된장의 제조 방법에 따른 차이로 판단 된다(Jeon 등 2016). 시료별 담금 초기 균수가 다른 것은 메주 의 수분함량과 표면적인 영향으로 생각된다(Lee 등 2012).

    경남지역 전통 된장의 곰팡이는 담금 직후 평균적으로 4.49 Log CFU/g의 값을 보였고, 숙성 후 1.35 Log CFU/g의 값 으로, 숙성함에 따라 곰팡이 수가 감소되거나 검출되지 않았 다. Gil 등(2017)의 연구에서는 Aspergillus oryzae를 접종하여 콩알메주 된장을 제조하여 곰팡이를 측정하였는데, 발효 초 기 6.45~5.65 Log CFU/g에서 발효 기간 동안 점차적으로 감 소하다가, 발효 8주차에는 모든 시료에서 검출되지 않았다고 보고하였고, Jang 등(2000)의 연구에서도 발효가 진행됨에 따 라 점차적으로 감소하는 경향을 보여, 본 연구결과와 유사한 결과를 나타내었다. 식중독균으로 알려져 있는 바실러스 세 레우스 균은 평균적으로 1.97 Log CFU/g에서 숙성 후 1.72 Log CFU/g으로 감소하였다. GD1, GD3 시료는 모두 불검출 이고, GD6 시료는 초기에 검출되었다가 210일 숙성 후 검출 되지 않았다. 바실러스 세레우스의 경우 국내 장류식품 기준 규격(KFDA 2015)에서 10,000 CFU/g 이하로 규정이 되어 있 는데, 7개 시료 모두 낮은 값으로 검출되어 규격에 적합한 안전한 범위의 품질을 보였다. 분변오염의 지표 미생물인 대 장균군은 모든 시료에서 검출되지 않았다. Jeon 등(2016)의 연구에서도 전통된장의 대장균군이 검출되지 않았으며, 본 연구결과와 일치하였다. 된장 숙성 시 유산균은 오염균을 방 지하는 반면, 과도한 증식은 된장에 강한 신맛을 부여하여 기호도에 영향을 준다(Choi 등 2017). 경남지역 전통 된장의 유산균은 숙성 초기 2.86~7.94 Log CFU/g에서 2.27~6.78 Log CFU/g으로 감소하는 경향을 보였다. Lee 등(2012)의 연구에 서는 쌀된장의 숙성 초기 균수는 6.86~8.02 Log CFU/g에서 42일 에는 2.00~ 4.69 Log CFU/g으로 숙성기간 동안 지속적으로 감 소하여, 본 연구결과와 유사한 경향을 보였다. 또한 Choi 등 (2017)의 연구에서도 전통 된장이 담금 초기에는 유산균이 검출되었으나, 1개월 후 감소하는 경향을 보이다가, 2개월 숙성 후 모든 시료들에서 유산균이 검출되지 않았다.

    7. 미생물 군집 조사

    경남지역에서 선정된 4개(고성, 사천, 하동, 함양) 지역 전 통 된장의 숙성 초기 및 숙성 후의 미생물 군집을 본 결과는 Fig. 2 및 Table 3과 같다. 된장의 진균 분포도는 문(Phylum) 수 준에서는 Ascomycota 문이 99.16%로 우점균을 형성하고 있었 다. 진균은 지역별로 발효 전․후 서로 우점균들이 다르게 형 성하였고, 숙성 전에는 모든 지역에서 공통적으로 Aspergillus oryzae 종이 검출되었다. 숙성 전 Aspergillus oryzae 종이 고성 (99.98%) 및 함양(47.61%) 지역에서 우점하고 있었으나, 숙성 후에는 고성 지역은 Candida versatilis 종(75.73%)으로 우세하 였다. 사천 지역은 숙성 전 Microascus brevicaulis 종이 41.84% 로 우점균을 형성하였는데, 숙성 후에는 Candida apicola 종 이 99.23%로 우점균을 형성하였다. 하동 지역은 숙성 전․후 동일하게 Debaryomyces hansenii 종이 80.57~84.15% 수준으 로 우점하고 있었다. 함양 지역은 숙성 후에는 Aspergillus oryzaeSterigmatomyces halophilus 종이 감소하고, Candida versatilis 종이 67.70%로 우점하고 있었다. 된장의 세균 분포 도는 문(Phylum) 수준에서는 Firmicutes 문이 88.32%로 우점 균을 형성하고 있었으며, 이 외에도 Proteobacteria 문이 11.59%의 비율로 우점하고 있었다. 숙성 전․후 모든 지역에 서 공통적으로 Tetragenococcus halophilus 종이 검출되었다. 고성 지역은 숙성 전 Enterococcus hirae 종이 77.40%에서 숙 성 후에는 Tetragenococcus halophilus 종이 34.74%로 우점균 을 형성하였다. 사천 및 하동 지역은 숙성 전․후는 동일하 게 Tetragenococcus halophilus 종이 우세하였고, 이 외에도 Enterococcus hirae 종이 우점균 다음으로 미생물 군집을 형 성하였다. 함양 지역은 숙성 후에는 Cronobacter sakazakii 종 이 63.51%로 우점균을 형성하였다. Cho 등(2017)의 연구에서 는 권역별(제주 및 호남권)로 전통된장을 1년간 숙성 후 미생 물 군집을 보았는데, 제주 지역에서 진균 및 세균 모두 본 연구의 고성 지역과 동일한 종이 우점하고 있는 결과를 보였 다. 이 외에는 숙성 후 지역별로 서로 다른 우점균을 형성하 였으며, 이는 메주 숙성 조건에 따라 표면에 자라는 미생물, 된장 숙성 조건, 장독 내부 환경 등에 따라 다르게 미생물 군집을 형성하는 것으로 판단된다.

    요약 및 결론

    본 연구는 경남지역의 전통 장류 제조업체를 지역별로 7 개소(고성, 사천, 산청, 의령, 하동, 함안, 함양)를 선정하여 전 통 재래식 된장으로 제조하여 숙성 기간에 따른 품질 특성 및 미생물 변화를 비교 분석하였다. 수분함량 및 염도는 숙 성 후 지역별로 각각 다른 경향을 보였다. 수분함량은 담금 직후 56.42~63.67%에서 숙성 후 56.40~65.21%의 함량을 나타 냈고, 염도는 담금 직후 9.24~26.81%에서 210일 숙성 후 9.05~16.08%의 값을 나타냈다. 명도는 숙성 기간이 경과함에 따라 유의적으로 감소하는 경향을 보였고, 적색도는 증가하 였다(p<0.05). 황색도는 지역별로 일정한 경향은 없었고, 21.39~26.81에서 숙성 후 21.10~28.36의 값을 보였다. pH는 숙성 후 4.88~6.86의 범위를 나타냈다. 산도는 0.85~1.67%에 서 0.64~2.14%로 숙성 후 유의적으로 증가하였다(p<0.05). 환 원당은 숙성 후 0.11~3.13%의 범위를 보였으며, 두 지역을 제 외하고 전반적으로 감소하였다. 아미노태 질소는 담금 직 후 141.87~495.13 mg/100 g에서 숙성 후 328.53~823.67 mg/100 g 으로 점차적으로 증가하였고, 전통식품 표준규격에 따라 7개 지역 모두 적합하였다(p<0.05). 암모니아태 질소 함량은 숙 성 후 128.62~331.00 mg/100 g으로 전반적으로 감소하는 경 향을 보였다. 총 균수는 숙성 후 전반적으로 유의적 차이가 없었으나, GD4 시료만 감소하는 경향을 보였다. 곰팡이는 숙 성함에 따라 전반적으로 감소하거나 검출되지 않았다. 식중 독균으로 알려져 있는 바실러스 세레우스 균은 평균적으로 감소하였고, GD1, GD7 시료에서는 모두 검출되지 않았다. 분변오염의 지표인 대장균군은 모든 지역에서 검출되지 않 았다. 유산균은 숙성 초기 숙성 기간이 경과함에 따라 감소 하는 경향을 보였다. 미생물 군집 결과 숙성 전 진균 분포도 는 모든 지역에서 공통적으로 Aspergillus oryzae 종이 검출되었 고, 숙성 후에는 지역 구분 없이 Candida versatilis 종(75.73%), Candida apicola 종(99.23%), Debaryomyces hansenii 종(84.15%) 및 Candida versatilis 종(67.70%)이 우세하였다. 세균 분포도 는 숙성 전․후 모든 지역에서 공통적으로 Tetragenococcus halophilus 종이 검출되었고, 숙성 후에는 Tetragenococcus halophilus 종 및 Cronobacter sakazakii 종이 우세하였다.

    감사의 글

    본 연구는 농촌진흥청 공동연구과제사업(PJ01345609)의 지원에 의해 이루어진 것입니다.

    Figure

    KSFAN-34-1-58_F1.gif
    Changes of color(L, a and b) of traditional doenjang in gyeongnam province during aging period.

    GD1: Goseong, GD2: Sacheon, GD3: Sancheong, GD4: Uiryeong, GD5: Hadong, GD6: Haman GD7: Hamyang. Mean±S.D (n=3), Means with different capital letters (regions) and small letters (aging period) are significantly different between groups at p<0.05 level by Duncan’s multiple range test.

    KSFAN-34-1-58_F2.gif
    Comparison of microbial community of traditional doenjang in Gyeongnam province by aging period.

    1) GD5B, GD2B, GD1B and GD7B: Hadong, Sacheon, Goseong and Hamyang before aging, respectively. 2) GD5A, GD2A, GD1A, GD7A: Hadong, Sacheon, Goseong and Hamyang after aging, respectively. 3) BC(Blue color): Ascomycota(91.6%), OC(Orange color): Basidiomycota(6.9%), PC(purple color): Mucoromycota(1.3%). 4) GC(Green color): Firmicutes(79.1%), YC(Yellow color): Proteobacteria(20.9%).

    Table

    Changes of quality characteristics of traditional doenjang in Gyeongnam province during aging period
    Changes of microorganism of traditional doenjang in Gyeongnam province during aging period
    Comparison of microbial community of traditional doenjang in Gyeongnam province by aging period

    Reference

    1. Ahn JB , Park JA , Jo HJ , Woo IH , Lee SH , Jang KI. 2012. Quality characteristics and antioxidant activity of commercial Doenjang and traditional Doenjang in Korea. Korean J Food Nutr 25:142-148
    2. Bae CR , Kwon DY , Cha YS. 2013. Anti-obesity effects of salted and unsalted Doenjang supplementation in C57BL/6J mice fed with high fat diet. J Korean Soc Food Sci Nutr 42: 1036-1042
    3. Baek SY , Gil NY , Han MH , Kang HY , Lee HY , Yoon HS , Lee J , Song YE , Lee SK , Ryu JA , Kim HY , Yeo SH , Kim SY. 2019. Relationship between exterior environment and quality characteristics of the traditional Gochujang produced in 2018 by eight regions in Korea. Korean J Food Preserv 26:745-755
    4. Byun MW , Nam TG , Chun MS , Lee GH. 2014. Physicochemical and sensory characteristics of Doenjang made by traditional methods. J Korean Soc Food Sci Nutr 43:1543-1548
    5. Cho EY , Yoon HH. 2020. Quality characteristics of Cheongkookjang made with lentils according to fermentation time. Culi Sci Hosp Res 26:203-213
    6. Cho KM , Kang JR , Kim GM , Kang MJ , Hwang CE , Jeong YS , Kim JH , Lee CK , Shin JH. 2014. Quality characteristics of low salted garlic Doenjang during fermentation. Korean J Food Preserv 21:627-635
    7. Cho SH , Park HS , Jo SW , Yim EJ , Yang HY , Ha GS , Kim EJ , Yang SJ , Jeong DY. 2017. Comparison of microbial community profiling on traditional fermented soybean products (Deonjang, Gochujang) produced in Jeonbuk, Jeonnam, and Jeju province area. Korean J Microbiol 53:39-48
    8. Choi BY , Gil NY , Mun JY , Yeo SH , Kim SY. 2018. Changes in the physicochemical characteristics of low-salt Doenjang by addition of halophytes. Korean J Food Preserv 25: 819-829
    9. Choi BY , Gil NY , Park SY , Cho YS , Kim SY. 2017. Change of quality properties of Doenjang according to soaking method in brine. Korean J Food Preserv 24:923-933
    10. Chung SK , Lee KS , Cho SH. 2004. Effect of fermentation vessel on quality of anchovy soy sauce. Korean J Food Preserv 11:233-239
    11. Gil NY , Choi BY , Park SY , Cho YS , Kim SY. 2017. Physicochemical properties of Doenjang using grain type Meju fermented by Aspergillus oryzae and protease. Korean J Food Preserv 24:697-706
    12. Himenokunio M , Kodegen K , Hubetadaba L. 1973. Browning and reducing material of the grain for processing Miso. Sci Tech Miso 277:28-34
    13. Hwang CE , Joo OS , Lee JH , Song YH , Hwang IG , Cho KM. 2017. Changes of physiochemical properties and biological activity during the fermentation of Doenjnag with bitter melon (Momordica charantia L.). Korean J Food Preserv 24:134-144
    14. Jang SM , Lee JB , An H , Rhee CH , Park HD. 2000. Changes of microorganisms, enzyme activity and physiological functionality in the Korean soybean paste with various concentrations of Ginseng extract during fermentation. Korean J Food Preserv 7:313-320
    15. Jeon DY , Yoon GB , Yoon YH , Yang SI , Kim JB. 2016. Bacterial community of traditional Doenjang in longevity area and antagonistic effect against Bacillus cereus. J Korean Soc Food Sci Nutr 45:1035-1040
    16. Jeong MW , Jeong JK , Kim SJ , Park KY. 2013. Fermentation characteristics and increased functionality of doenjang prepared with bamboo salt. J Korean Soc Food Sci Nutr 42:1915-1923
    17. Joo HK , Kim DH , Oh KT. 1992. Chemical composition changes in fermented Doenjang depend on Doenjang koji and its mixture. J Korean Agric Chem Soc 35:351-360
    18. Kang JE , Choi HS , Choi HS , Park SY , Song J , Choi JH , Yeo SH , Jung ST. 2013. The quality characteristics of commercial deonjang certified for traditional foods. Korean J Community Living Sci 24:537-542
    19. Kang JR , Kim GM , Hwang CR , Cho KM , Hwang CE , Kim JH , Shin JH. 2014. Changes in quality characteristics of soybean paste Doenjang with addition of garlic during fermentation. Korean J Food Cookery Sci 30:435-443
    20. Kim GY , Moon HK , Lee SW , Moon JN , Yoon WJ. 2010. Effect of mixed soybeans materials on qulity characteristics of traditional soybean paste (Doenjang) during aging. Korean J Food Cookery Sci 26:314-322
    21. Kim JG. 2004. Changes of components affecting organoleptic quality during the ripening of traditional Korean soybean paste-amino nitrogen, amino acids, and color. J Food Hyg Saf 19:31-37
    22. Kim JH , Yoo JS , Lee CH , Kim SY , Lee SK. 2006. Quality properties of soybean pastes made from meju with mold producing protease isolated from traditional meju. J Korean Soc Appl Biol Chem 49:7-14
    23. Kim MS , Kim EM , Chang KS. 2008. Effect of fermentation temperature on quality of Doenjang. J Agric Sci Chungnam Natl Univ 35:1-9
    24. Kim SH , Kim SJ , Kim BH , Kang SG , Jung ST. 2000. Fermentation of doenjang prepared with sea salts. Korean J Food Sci Technol 32:1365-1370
    25. Kim YS , Jeong DY , Hwang YT , Uhm TB. 2011a. Bacterial community profiling during the manufacturing process of traditional soybean paste by pyrosequencing method. Korean J Microbiol 47:275-280
    26. Kim YS , Kim JY , Choi HS. 2011b. Quality characteristics of commercial rice soybean paste. Korean J Food Preserv 18: 853-858
    27. Korean Food and Drug Administration [KFDA].2015. Korean Food Standards Codex. Korean Food and Drug Administration
    28. Ku KH , Park K , Kim HJ , Kim Y , Koo M. 2014. Quality characteristics of Doenjang by aging period. J Korean Soc Food Sci Nutr 43:720-728
    29. Kwak EJ , Park WS , Lim SI. 2003. Color and quality properties of doenjang added with citric acid and phytic acid. Korean J Food Sci Technol 35:455-460
    30. Lee HT , Kim JH , Lee SS. 2009. Analysis of microbiological contamination and biogenic amines content in traditional and commercial Doenjang. J Food Hyg Saf 24:102-109
    31. Lee JH , Lim YI , Lee SY , Kim JH , Park KY. 2020. Increased qualities and in vitro anticancer effects of ‘Doenjang’ fermented in ‘Onggi’. Korean J Food Preserv 27:346-355
    32. Lee JJ , Kim AR , Lee H , Kim CH , Chang HC , Lee MY. 2011. Effects of soybean, Cheonggukjang and Doenjang on serum cholesterol level and weight reduction in rats fed a highfat/ high cholesterol diet. Korean J Food Preserv 18:226-235
    33. Lee JS , Kwon SJ , Chung SW , Choi YJ , Yoo JY , Chung DH. 1996. Changes of microorganisms, enzyme activitis and major components during the fermentation of Korean traditional Doenjang and Kochujang. Korean J Appl Microbiol Biotechnol 24:247-253
    34. Lee KH , Choi HS , Hwang KA , Song J. 2016. Quality changes in doenjang upon fermentation with two different Bacillus subtilis strains. J East Asian Soc Diet Life 26:163-170
    35. Lee SM , Chang HC. 2009. Growth-inhibitory effect of the solar salt-Doenjang on cancer cells, AGS and HT-29. J Korean Soc Food Sci Nutr 38:1664-1671
    36. Lee SY , Park NY , Kim JY , Choi HS. 2012. Quality characteristics of rice-doenjang during fermentation by differently shaped meju and adding starter. Korean J Food Nutr 25: 505-512
    37. Min SH. 2006. Quality characteristics of Doenjang containing Astragalus membranaceus water extracts. Korean J Food Cookery Sci 22:514-520
    38. Paek HY , Kim JH , Kwak EJ. 2019. Quality characteristics of Doenjang added with root vegetables powder. J East Asian Soc Diet Life 29:326-335
    39. Park KY , Son MH , Moon SH , Kim KH. 1999. Cancer preventive effects of Doenjang in vitro and in vivo. J Korean Assoc Cancer Prev 4:68-78
    40. Park SY , Kim S , Hong SP , Lim SD. 2016. Analysis of quality characteristics of regional traditional and commercial soybean pastes (Doenjang). Korean J Food Cookery Sci 32:686-695
    41. Park SY , Kim SK , Hong SP , Lim SD. 2017. Analysis of quality characteristics of traditional and commercial red pepper pastes (Gochujang). Korean J Food Cookery Sci 33:137-147
    42. Seo JS , Han EM , Lee TS. 1986. Effect of meju shapes and strains on the chemical composition of soybean paste. J Korean Soc Food Nutr 15:1-9
    43. Song YE , Han HA , Lee SI , Shin SH , Choi SR , Kim SY. 2019. Quality characteristics and antioxidant activity of regional traditional soybean pastes (Deonjang) in Jeonbuk province. Korean J Food Nutr 32:598-610
    44. Yang BK , Park JB , Ha SO , Kim KY , Kym KH , Park KY , Yun JW , Song CH. 2000. Hypolipidemic effect of extracts of soybean paste containing mycelia of mushrooms in hyperlipidemic rats. Korean J Appl Microbiol Biotechnol 28:228- 232
    45. Yang HJ , Kim MJ , Hong SP. 2019. Anti-diabetic effect of Ganjang and Doenjang in different aging periods. Korean J Food Preserv 26:300-307
    46. Yoo SK , Kang SM , Noh YS. 2000. Quality properties on soy bean pastes made with microorganisms isolated from traditional soy bean pastes. Korean J Food Sci Technol 32:1266-1270
    47. Yoon HS , Lee SH , Kang HJ , Eom HJ , Kim Y. 2019. Physicochemical and flavor characteristics of Doenjang in Chungbuk provinces during fermentation. Korean J Food Nutr 32:687-695